The Music of Life

[pasithea]

It's... beautiful...

http://whozoo.org/mac/Music/Primer/ProteinCodonScale.mp3

Move up the directories and look at what this is. Music generated from DNA
sequences. In some way it simplifies them so much too. You might never remember GAACAACCAGAACCCAAGGG but transformed into a melody...

Imagine it. All that you are physically could be turned into a strange beautiful and mysterious song.

Comments

[lazarian.livejournal.com]

Hope that the RIAA doesn't get wind of this.