The Music of Life
Jun. 18th, 2007 10:40 amIt's... beautiful...
http://whozoo.org/mac/Music/Primer/ProteinCodonScale.mp3
Move up the directories and look at what this is. Music generated from DNA
sequences. In some way it simplifies them so much too. You might never remember GAACAACCAGAACCCAAGGG but transformed into a melody...
Imagine it. All that you are physically could be turned into a strange beautiful and mysterious song.
http://whozoo.org/mac/Music/Primer/ProteinCodonScale.mp3
Move up the directories and look at what this is. Music generated from DNA
sequences. In some way it simplifies them so much too. You might never remember GAACAACCAGAACCCAAGGG but transformed into a melody...
Imagine it. All that you are physically could be turned into a strange beautiful and mysterious song.
(no subject)
Date: 2007-06-18 06:37 pm (UTC)Yes, but what if it turns out, instead, to be, like, the Macarena, followed by Hit Me Baby One More Time, and then a protein sequence of My Heart Will Go On (Which, ironically enough, is used to express part of the bladder)? There are some things too horrific to dare ask!
(no subject)
Date: 2007-06-19 06:51 am (UTC)No, what's really horrifying to imagine is if we generate a DNA sequence based on those songs, inject it into a cell, and it grows into a 500-foot-tall monster that devours us all!
(no subject)
Date: 2007-06-19 07:27 am (UTC)(no subject)
Date: 2007-06-19 07:46 pm (UTC)