The Music of Life
Jun. 18th, 2007 10:40 am![[personal profile]](https://www.dreamwidth.org/img/silk/identity/user.png){kind=small}
pasitheaIt's... beautiful...
http://whozoo.org/mac/Music/Primer/ProteinCodonScale.mp3
Move up the directories and look at what this is. Music generated from DNA
sequences. In some way it simplifies them so much too. You might never remember GAACAACCAGAACCCAAGGG but transformed into a melody...
Imagine it. All that you are physically could be turned into a strange beautiful and mysterious song.
http://whozoo.org/mac/Music/Primer/ProteinCodonScale.mp3
Move up the directories and look at what this is. Music generated from DNA
sequences. In some way it simplifies them so much too. You might never remember GAACAACCAGAACCCAAGGG but transformed into a melody...
Imagine it. All that you are physically could be turned into a strange beautiful and mysterious song.
