pasithea: glowing girl (Default)
pasithea ([personal profile] pasithea) wrote2007-06-18 10:40 am

The Music of Life

It's... beautiful...

http://whozoo.org/mac/Music/Primer/ProteinCodonScale.mp3

Move up the directories and look at what this is. Music generated from DNA
sequences. In some way it simplifies them so much too. You might never remember GAACAACCAGAACCCAAGGG but transformed into a melody...

Imagine it. All that you are physically could be turned into a strange beautiful and mysterious song.

[identity profile] yetanotherbob.livejournal.com 2007-06-18 06:37 pm (UTC)(link)
All that you are physically could be turned into a strange beautiful and mysterious song.

Yes, but what if it turns out, instead, to be, like, the Macarena, followed by Hit Me Baby One More Time, and then a protein sequence of My Heart Will Go On (Which, ironically enough, is used to express part of the bladder)? There are some things too horrific to dare ask!

[identity profile] kinkyturtle.livejournal.com 2007-06-19 06:51 am (UTC)(link)
She did say "beautiful and mysterious". :}

No, what's really horrifying to imagine is if we generate a DNA sequence based on those songs, inject it into a cell, and it grows into a 500-foot-tall monster that devours us all!

[identity profile] kinkyturtle.livejournal.com 2007-06-19 07:27 am (UTC)(link)
Um... that link doesn't work. It gives me a page saying "No direct link to images" and little else of any help. I assume you found it on http://whozoo.org/mac/Music/Primer/Primer_index.htm ?

[identity profile] lazarian.livejournal.com 2007-06-19 07:46 pm (UTC)(link)
Hope that the RIAA doesn't get wind of this.