Jun. 18th, 2007

pasithea: glowing girl (Default)
It's... beautiful...

http://whozoo.org/mac/Music/Primer/ProteinCodonScale.mp3

Move up the directories and look at what this is. Music generated from DNA
sequences. In some way it simplifies them so much too. You might never remember GAACAACCAGAACCCAAGGG but transformed into a melody...

Imagine it. All that you are physically could be turned into a strange beautiful and mysterious song.
pasithea: glowing girl (Default)
Why yes, I do come from the whitest place on the fucking planet.

http://www.newsvine.com/_news/2007/06/15/783943-rusty-1957-plymouth-unearthed-in-okla

I particularly love the 'contents of an average woman's handbag'.

So apparently the conservatives are spot on for once. Children WERE better behaved and divorce rates WERE lower. It all makes sense now.

For some reason I find the video of the event outrageously funny. http://www.tulsaworld.com/webextra/content/2007/videos/belvedere/qt.html

Something about a gazillion white people gathered around a rusted out old car, calling it Mrs Belvedere and saying it REALLY shows how GREAT Tulsa is.

Yes, Maybelle, it does. It really really does.

Edit: If you need to know more about the wonder of Oklahoma, may I introduce you to Noodling. http://video.google.com/videoplay?docid=-3735336138652309832 Ashy, you should watch this. It has animation and music and is deeply horrible.

If you need more proof, I dare you to search for 'catfish heads fence' on google.

February 2012

S M T W T F S
   1234
567891011
12 131415161718
19202122232425
26272829   

Most Popular Tags

Style Credit

Expand Cut Tags

No cut tags
Page generated Jan. 29th, 2026 12:00 am
Powered by Dreamwidth Studios